| |
| RNA Isolation and Enrichment: RNA species in the 18 to 26 nucleotide size range are purified from total RNA. Best results are obtained if 50-100 µg of total RNA is used; however, cloning can be performed with less mass if RNA is scarce. This size range contains mature microRNA sequences. Several options are available for purification, including denaturing PAGE, the miRVana™ kit (Ambion®), or the flashPAGE™ fractionator (Ambion®). | | Cloning Linker Attachment: The 3’ and 5’ cloning linkers are ligated to purified small RNA species in preparation for cDNA synthesis and amplification. | | Amplification and Cloning: Reverse transcription of the linkered RNA species is carried out followed by PCR amplification and cloning. Two cloning options are available. The preferred option is a SAGE-like method where the small RNA cloning units (miRNA + linkers) are serially ligated (concatemerized) and then cloned. This method is more efficient when using sequencing platforms with long read lengths. The second option is to directly clone the PCR amplicons. In both options, cloning can be done using any available PCR cloning vectors. | | Sufficient materials are provided in the kit to generate more than ten small RNA libraries. The two most important aspects of miRNA cloning are the quantity and quality of the starting RNA and the maintenance of relative mass relationships during the Cloning Linker Attachment Phase. Total cellular RNA can be used to clone small RNA species but the absolute mass of small RNAs is very small and larger RNA species will compete for linker molecules. For this reason, it is best to prepare a highly enriched and purified small RNA fraction at the outset. | | Once purified small RNA species are obtained, it is crucial to use sufficient linker mass to ensure efficient 3’ and 5’ linker attachment. We strongly encourage using the 3’ and 5’ linkers in the amounts and the concentrations called for in the Cloning Linker Attachment Phase. Reductions in the mass of linker in either of the linker steps will result in a substantial reduction in linkering efficiencies. | |
- Bartel, D.P., MicroRNAs: genomics, biogenesis, mechanism, and function. Cell, 2004. 116(2): p. 281-97.
- Lee, R.C., R.L. Feinbaum, and V. Ambros, The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell, 1993. 75(5): p. 843-54.
- Gregory, R.I., et al., The Microprocessor complex mediates the genesis of microRNAs. Nature, 2004. 432(7014): p. 235-40.
- Denli, A.M., et al., Processing of primary microRNAs by the Microprocessor complex. Nature, 2004. 432(7014): p. 231-5.
- Berezikov, E., E. Cuppen, and R.H. Plasterk, Approaches to microRNA discovery. Nat Genet, 2006. 38 Suppl: p. S2-7.
- Cummins, J.M., et al., The colorectal microRNAome. Proc Natl Acad Sci U S A, 2006. 103(10): p. 3687-92.
- Elbashir, S.M., W. Lendeckel, and T. Tuschl, RNA interference is mediated by 21- and 22-nucleotide RNAs. Genes Dev, 2001. 15(2): p. 188-200.
- Lau, N.C., et al., An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science, 2001. 294(5543): p. 858-62.
- Pfeffer, S., M. Lagos-Quintana, and T. Tuschl, Cloning of small RNA molecules. Current protocols in Molecular Biology, 2003: p. 26.4.1-26.4.18.
- Sunkar, R. and J.K. Zhu, Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell, 2004. 16(8): p. 2001-19.
|
|
miRCat™ small RNA cloning is based upon the pre-activated, adenylated RNA linkering method that has been used successfully in many labs since its development in 20011. This method permits cloning from any RNA source in any species. miRCat-33™ is a conversion of the miRCat™ kit for the purpose of carrying out 5’ ligation-independent small RNA cloning using the method of Pak and Fire2.
| |
| Material sufficient for ten cloning experiments is provided in the miRCatTM kit. | | Kit Contents: | - 3’ Linker 1 pre-activated, adenylated cloning linker
- 5’ M.R.S. cloning linker
- miSPIKE 21-mer internal RNA control
- Forward and Reverse/RT primers
- T4 RNA Ligase
- Ligation buffer w/o ATP
- Ligation Enhancer
- 10mM ATP
- T4 DNA Ligase
- 3M NaOAc (pH 5.2)
- 10mg/ml Glycogen
- IDTE (pH 7.5)
- IDT Water
- Technical Manual
- Edge Biosystems Gel Purification Columns
| | Description | Price | |
|---|
| miRCatTM RNA Cloning Kit | $895.00 USD | |
| |
| Kit Contents: | - Second 3’ pre-activated, adenylated cloning linker
Sequence- 5’- rAppTGGAATTCTCGGGTGCCAAGG/ddC/ -3’ - Replacement PCR Primer
Sequence- 5’- CCTTGGCACCCGAGAATT -3'
| | Description | Price | |
|---|
| 1 nm miRCat-33™ Conversion Oligo Pack | $175.00 USD | | | 5 nm miRCat-33™ Conversion Oligo Pack | $595.00 USD | |
| | miRCat-33™ is a conversion of the miRCat™ kit for the purpose of carrying out 5’ ligation-independent small RNA cloning using the method of Pak and Fire2. Primer is included at no charge. | |
| 454 Adaptor Primers are designed to convert the small RNA libraries generated by miRCat™ ligations (Set I) or by miRCat-33™ ligations (Set II) into 454-compatible PCR libraries for deep sequencing4. |  |
|
| Linker-1 is the original modban sequence employed by Lau and Bartel in 20011 and contains a Ban-I restriction site. Linker-2 contains Ava-I and Sty-I restriction sites. Linker-3 contains EcoR-I and Msp-I restriction sites and was adapted from Pfeffer and Tuschl3. All three linkers are modified with a 3’-terminal dideoxy-C (ddC) base to prevent self ligation. Experiments have shown miRNA linker performance can vary depending on the RNA source. For this reason, the miRNA Cloning Linker Pack – 3 Linker Types, 1 nmole each, provides small samples of each of the three linkers and is useful for optimizing methods before using precious RNA samples in large-scale library construction. | | Linker oligonucleotides are provided lyophilized and are ready for use in cloning; just resuspend at the desired concentration and add to your ligation mix (using T4 RNA Ligase without ATP). Use of this reagent can improve cloning efficiency of miRNAs, which have a 5'-phosphate and will circularize if attachment of linkers is attempted using RNA Ligase in the presence of ATP. | | Modifications: | 5′-adenylated; fully activated and ready for use
3′-end blocked with a dideoxy-C base |
|---|
| Purification: | HPLC |
|---|
| Quality Control: | Identity confirmed by ESI mass spectrometry
Tested for reactivity with RNA ligase
Certificate of Analysis for each linker available online here |
|---|
| | Description | Sequence | Price | |
|---|
| 1 nm miRNA Cloning Linker 1 | /5rApp/CTGTAGGCACCATCAAT/3ddC/ | $175.00 USD | | | 1 nm miRNA Cloning Linker 2 | /5rApp/CACTCGGGCACCAAGGA/3ddC/ | $175.00 USD | | | 1 nm miRNA Cloning Linker 3 | /5rApp/TTTAACCGCGAATTCCAG/3ddC/ | $175.00 USD | | | 5 nm miRNA Cloning Linker 1 | /5rApp/CTGTAGGCACCATCAAT/3ddC/ | $595.00 USD | | | 5 nm miRNA Cloning Linker 2 | /5rApp/CACTCGGGCACCAAGGA/3ddC/ | $595.00 USD | | | 5 nm miRNA Cloning Linker 3 | /5rApp/TTTAACCGCGAATTCCAG/3ddC/ | $595.00 USD | | | miRNA Cloning Linker 3-Pack – 3 Linkers, 1 nm each | | $450.00 USD | |
| |
| T4 RNA Ligase uses ATP to adenylate the 5'-end of a single-strand nucleic acid sequence. This activated adenylated-oligo is then covalently connected (ligated) to the 3'-OH of a second single-stranded sequence. Adenylated oligonucleotides containing a pyrophosphate linkage are substrates for T4 RNA Ligase in the absence of ATP (11). IDT will custom adenylate an oligonucleotide for use with RNA-Ligase using the chemical adenylation method of Unrau and Bartel (12). T4 RNA Ligase will use an adenylated DNA linker with similar efficiency as an adenylated RNA linker and IDT recommends use of adenylated DNA oligos for this application. Note that IDT requires blocking the 3’-end of an adenylated oligo so it cannot circularize; use of either 3’-Spacer C3 /3SpC3/ or dideoxycytosine /3ddC/ is preferred. brary construction. | | References | - England, T.E., Gumport, R.I. and Uhlenbeck, O.C. (1977) Dinucleoside pyrophosphate are substrates for T4-induced RNA ligase. Proc Natl Acad Sci U S A, 74, 4839-4842.
- Unrau, P.J. and Bartel, D.P. (1998) RNA-catalysed nucleotide synthesis. Nature, 395, 260-263.
|
These prices are for the modification only, standard base and purification charges will apply for the rest of the oligonucleotide.
| Scale | Price | |
|---|
| 250 nm | $995.00 USD | | | 1 µm | $1,750.00 USD | | | 5 µm | $4,500.00 USD | | | 10 µm | $6,750.00 USD | |
| |
| The 5’ M.R.S Linker sequence is designed for use with any of the 3’ miRNA Cloning linkers. The sequence has been optimized for linking to the 5’ end of RNAs containing a 5’ phosphate group. The reaction is carried out with T4 RNA Ligase in the presence of 1 mm ATP. The sequence contains restriction endonuclease recognition sites compatible with Ban 1 (Linker 1), Sty I and Ava I (Linker 2) and EcoRI (Linker 3). Upon reverse transcription of doubly linked RNAs, the restriction endonuclease appropriate for the 3’ cloning linker will also generate compatible ends in the 5’ M.R.S Linker sequence permitting concatamerization and/or cloning. Further, the additional restriction sites in the M.R.S Linker, when matched with specific 3’ linkers can generate ends for directional cloning. For example, M.R.S Linker/Linker 3 digestion with Eco RI and Ban I will leave a Ban I 5’ end and an Eco RI 3’ end. | |
| miSPIKE is a synthetic 21-mer RNA whose sequence does not match any known small RNA sequence in GenBank, miRBase, or RNAdb. The RNA oligonucleotide was synthesized without a 5’ phosphate so that the marker can serve as both a size marker for small RNA enrichment on a denaturing acrylamide gel and as a 3’ ligation control but is inert to 5’ ligation. | | Sequence: 5′- rCrUrCrArGrGrArUrGrGrCrGrGrArGrCrGrGrUrCrU -3′ |
These prices are for the modification only, standard base and purification charges will apply for the rest of the oligonucleotide.
| Description | Price | |
|---|
| 100 pm miSPIKETM Internal RNA Control | $25.00 USD | |
| |
| piSPIKE is a synthetic 31-mer RNA whose sequence is a ten nucleotide extension of miSPIKE and is also synthesized without a 5’ phosphate. | | Sequence: 5′- rCrUrCrArGrGrArUrGrGrCrGrGrArGrCrGrGrUrCrUrCrArCrUrGrArArCrGrU -3′ |
These prices are for the modification only, standard base and purification charges will apply for the rest of the oligonucleotide.
| Description | Price | |
|---|
| 100 pm piSPIKETM Internal RNA Control | $35.00 USD | |
|
| |
|